Skip to main content

Table 6 Primers and probes used for p53 mutation analysis

From: Cyclin A1 shows age-related expression in benign tonsils, HPV16-dependent overexpression in HNSCC and predicts lower recurrence rate in HNSCC independently of HPV16

Exon Primer Sequences (5’ → 3’) Annealing Temperature (°C)
2-4 A1 forward TCAGACACTGGCATGGTGTTG 64
reverse AGGGTGAAGAGGAATCCCAAAG
A2 forward GTGAGTGGATCCATTGGAAG 64
reverse GTGAAAAGAGCAGTCAGAGG
5/6 B forward TAGTGGGTTGCAGGAGGTGC 62
reverse GAGGCCCTTAGCCTCTGTAAGC
7 C forward CTGCTTGCCACAGGTCTCC 62
reverse CGGGGATGTGATGAGAGGTGG
8/9 D forward AAGGACAAGGGTGGTTGGGAG 62
reverse CAACCAGGAGCCATTGTCTTTG