Skip to main content

Table 5 Primers and probes used for HPV16-Real-Time PCR

From: Cyclin A1 shows age-related expression in benign tonsils, HPV16-dependent overexpression in HNSCC and predicts lower recurrence rate in HNSCC independently of HPV16

Gene Sequence (5’ → 3’)
HPV16 E6 Primer1, forward CTGCAATGTTTCAGGACCCA
Primer2, reverse TCATGTATAGTTGTTTGCAGCTCTGT
Probe FAM-AGGAGCGACCCAGAAAGTTACCACAGTT-TAMRA
HPV16 E7 Primer1, forward AAGTGTGACTCTACGCTTCGGTT
Primer2, reverse GCCCATTAACAGGTCTTCCAAA
Probe FAM-TGCGTACAAAGCACACACGTAGACATTCGTA-TAMRA
HBB Primer1, forward GTGAAGGCTCATGGCAAGAAAG
Primer2, reverse CAGCTCACTCAGTGTGGCAAAG
Probe FAM-ATGGCCTGGCTCACCTGGACAACC-TAMRA
  1. PCR: Polymerase chain reaction; HPV16: Human Papillomavirus 16; E6, E7: Oncogenes of HPV16; HBB: Human beta-globin.