Skip to main content

Table 1 Sequences of the PCR and pyrosequencing primers used in this study

From: Concurrent epigenetic silencing of wnt/β-catenin pathway inhibitor genes in B cell chronic lymphocytic leukaemia

Gene symbol Primer sequences (5´-3´) *
F: PCR forward; R: PCR reverse;
S: pyrosequencing; bio: biotinylation
Amplicon length, bp Number of CpGs quantified by pyrosequencing Reference
CDH1-F TTTTTTTTGATTTTAGGTTTTAGTGAG 421   [29]
CDH1-R bio-ACTCCAAAAACCCATAACTAACC    
CDH1-S AGTTAGTTTAGATTTTAGTT   9 this study
DACT1-F GTTTGGGAAGTGAAAGAAATTTAATT 184   [30]
DACT1-R bio-CTAAAACCCCAACATCCTATTACAAT    
DACT1-S AGATTGTGTTGTAATTTGGT   5 this study
DKK1-F bio-GGGGTGAAGAGTGTTAAAGGTT 326   [31]
DKK1-R AAACCATCATCTCAAAAAAACTCAA    
DKK1-S CTACAAAAAACACAAAACTCTAC   8 this study
DKK2-F bio-TTTTAGTAGTTGTGGGTGGAGATA 456   this study
DKK2-R ATACTCCTTTTCAAAATTAACAAAC    
DKK2-S CCTAACTCACAAAAAACAAC   11  
DKK3-F GATTTTGTTGAGTTTAGTTTTTTTTGGT 123   [32]
DKK3-R bio-CAAACCTCTCTCAACCCCTACCTA    
DKK3-S TTTTTTGGTGGATGTG   5 this study
DKK4-F bio-ATAGATTTGAAGGGATTTGTTGAAGTTT 328   [33]
DKK4-R CAAAACCAACTCAACCCCAACAAAAC    
DKK4-S CTAAACTAACAACTCAACAC   2 this study
SFRP1-F TTTTTAAGGGGTGTTGAGT 412   [16]
SFRP1-R CAAACTTCCAAAAACCTCC    
SFRP1-S GGAGTTGATTGGTTG (Sanger sequencing)    this study
SFRP2-F ATGTTTGGTAATTTAGTAGAAATTT 409   this study
SFRP2-R bio-CAACCAAAATTTTCTTAACCTTTTT    
SFRP2-S GATTGGGGTAAAATAAGTT   14  
SFRP3-F bio-GTGATTTAGGGGAGGAGATATTTTAGA 542   this study
SFRP3-R TTCCAAAACAAAAACTTACACAAAA    
SFRP3-S CAAAATAAAACAAAATACAAC   4  
SFRP4-F bio-GTGTTTTGTGTGTTAGA 220   [16]
SFRP4-R CCACTAAAATAAAAAAAAACATAACA    
SFRP4-S TACCACCCTCATCTTTC   2 this study
SFRP5-F GTAGGGAGTTTTGGGGAGAAA 272   [16]
SFRP5-R bio-CCCAAATAAATAACAACCTAC    
SFRP5-S GTTTTGGAGTTGGGGTTAG   8 this study
WIF1-F bio-GAGTGATGTTTTAGGGGTTT 414   [34]
WIF1-R CCTAAATACCAAAAAACCTAC    
WIF1-S AAACTACATTCACAATAC   7 this study
  1. * Primers of the same sequence but without biotin modification were employed for amplification of the PCR-products used for subcloning and bisulphite sequencing.