Skip to main content

Advertisement

Table 1 Primers for PCR, real-time PCR and Oligonucleotides for Rab11a gene silence

From: Impaired degradation followed by enhanced recycling of epidermal growth factor receptor caused by hypo-phosphorylation of tyrosine 1045 in RBE cells

EGFR exon 18 ~ 21 Sense cctaagatcccgtccatcgcc
  Antisense cactttgcctccttctgcatggta
EGFR exon 22 ~ 27 Sense ttgggctggccaaactgctgg
  Antisense caggcactgggaggaaggtgt
EGFR exon 28 Sense ccacaggcgccttgactgagga
  Antisense gcaacttcccaaaatgtgcccg
  Sense No.1 agtcgggctctggaggaa
  Antisense No.1 ggcagttctcctctccg
  Sense No.2 ctgtgcaacgtggagagc
EGFR Antisense No.2 ccatctcatagctgtcgg
exon 2 ~ 16 (5 pairs) Sense No.3 cccaccacgtaccagatg
  Antisense No.3 ccatgttgcttggtcctgcc
  Sense No.4 gctgattcaggcttggcc
  Antisense No.4 ctcaccctccagaagcttgc
  Sense No.5 ggtctgccatgccttgtg
  Antisense No.5 ggcccattcgttggacag
EGFR (real-time PCR) Sense gcacctacggatgcactgg
  Antisense ggcgatggacgggatctta
β-actin (real-time PCR) Sense acgtggacatccgcaaagac
  Antisense caagaaagggtgtaacgcaacta
Rab11a (real-time PCR) Sense ggcacagatatgggacacagc
  Antisense aaggcacctacagctccacg
Rab11a siRNA Sense aaugucagacagacgcgaaaatt
  Antisense uuuucgcgucugucugacauutt