Skip to main content

Table 1 Sequences of primers used in this study

From: Methylation profiling of Epstein-Barr virus immediate-early gene promoters, BZLF1 and BRLF1in tumors of epithelial, NK- and B-cell origins

vp Primers Sequence (5'-3') Product size Annealing Temp.(°C) Cycles
RT-PCR BZLF1F GGGAGAAGCACCTCAACCTG 255-bp 55 35
  BZLF1R TTGCTTAAACTTGGCCCGGC    
  BRLF1F CAAACAGACGCAGATGAGGC 443-bp 55 35
  BRLF1R GCGGTGCCTATGGTGGCAGG    
  BHRF1H2 GTCAAGGTTTCGTCTGTGTG 213-bp 55 35
  BHRF1H3 TTCTCTTGCTGCTAGCTCCA    
  BLLF1F GTGGATGTGGAACTGTTTCCAG 230-bp 55 35
  BLLF1R CTGTATCCACCGCGGATGTCAC    
  BARTA3 AGAGACCAGGCTGCTAAACA 232-bp 55 35
  BARTA4 AACCAGCTTTCCTTTCCGAG    
  GAPDHF GATGACCTTGCCCACAGCCT 303-bp 55 23
  GAPDHR ATCTCTGCCCCCTCTGCTGA    
MSP Zpm1 TCGGATTTTCGTGGGTTAATC 101-bp 64 42
  Zpm2 CGAAACTAACGTTAAAAATCCG    
  Zpu1 ATTTGGATTTTTGTGGGTTAATT 101-bp 62 40
  Zpu2 CCAAAACTAACATTAAAAATCCA    
  Rpm1 TAGGTATTTTGGATATTCGTAC 172-bp 64 42
  Rpm3 GATTTAATCCCAACCGCCG    
  Rpu1 TGTAGGTATTTTGGATATTTGTAT 78-bp 62 40
  Rpu2 CAAATCATTACTCCAAACTATCA    
BGS ZpMZP1 AAAAAACACCTAATATAAATCAAA 814-bp 62 42
  ZpSC22 GTTAAAGAGGATTAGGTTTTTTT    
  RpMRP1 TCTTTTATAAACCATTAACATAAA 599-bp 60 42
  RpMRP2 GAGATTGATAGGATTATATTGT