Skip to main content

Table 1 Details of PCR and RFLPs conditions for polymorphisms studied

From: Genetic polymorphisms in MMP 2, 9 and 3genes modify lung cancer risk and survival

Gene Polymorphism Primer sequence PCR Conditions Enzyme
MMP9 -1562C/T (F) GCCCGCTCTGGATTATACG
(R) CTATCATCTCCTGGCCCCC
28 cycles: 94°C 30s, 65°C 30s, 72°C 30s SphI
MMP2 -735C/T (F) ATAGGGTAAACCTCCCCACATT
(R) GGTAAAATGAGGCTGAGACCTG
30 cycles: 94°C 30s, 62°C 30s, 72°C 30s HinfI
MMP3 -1171 5A/6A (F) TTTCAATCAGGACAAGACgaaGTTT*
(R) GATTACAGACATGGGTCACA
30 cycles: 94°C 300s, 53°C 30s, 72°C 30s XmnI
  1. * modifíed bases