Table 1 Details of PCR and RFLPs conditions for polymorphisms studied
From: Genetic polymorphisms in MMP 2, 9 and 3genes modify lung cancer risk and survival
Gene | Polymorphism | Primer sequence | PCR Conditions | Enzyme |
|---|---|---|---|---|
MMP9 | -1562C/T | (F) GCCCGCTCTGGATTATACG (R) CTATCATCTCCTGGCCCCC | 28 cycles: 94°C 30s, 65°C 30s, 72°C 30s | SphI |
MMP2 | -735C/T | (F) ATAGGGTAAACCTCCCCACATT (R) GGTAAAATGAGGCTGAGACCTG | 30 cycles: 94°C 30s, 62°C 30s, 72°C 30s | HinfI |
MMP3 | -1171 5A/6A | (F) TTTCAATCAGGACAAGACgaaGTTT* (R) GATTACAGACATGGGTCACA | 30 cycles: 94°C 300s, 53°C 30s, 72°C 30s | XmnI |