Skip to main content

Table 1 Primers used for DNA methylation analysis.

From: Involvement of promoter methylation in the regulation of Pregnane X receptor in colon cancer cells

Gene Segment Primer sequence (5'-3') Annealing Product
    temp.(°C) size (bp)
  1F GAAGATAATTGTGGTTATTTTTTGGTA 55 574
  1R CCACCTCCCTAAATAATATTACT   
  2F GTTGTTTTTAGTGGTAAAGGATAGA 55* 602
  2R CACACACATCTTTTAACTAAAACT   
PXR 3F AGGATTTATTATTTTAAGGAGGGGTT 55 230
promoter 3R CCTTAAAACAATACCTCTAACCAT   
  4F GTAAGATTTGGAGATTTTTTATATTTG 55 318
  4R CTATCCTTCTCTACTAATAAAAATAC   
  COBRA GTAGGGAGAATATAATGAGAATAA 55* 209
   ACTAAAATAAAAACAATACTTCCTCTTCAC   
PXR F ATTTTTTTATAGGAGGGTTATGAAA 55 292
exon 3 R TACACACRAACACCAACTCACATAT   
CYP3A4 F GAGTTATGGTGGGTTTTATTTAG 55 438
5'UTR R TCTACATTTCCATCTAAAATACC   
VDR 1F ATAATTTTAGGTTTTAGGAGGTAG 60 400
promoter 1R CCTAAACTAACCAAACCAAAACTT   
  2F GGGTTGTTTTTGTTTGTTAAAAGG 60 373
  2R CTTATTACCCAAATACTAAACACT   
PRMT1 F AGGAGAAAGGGGGGGTTTTGGT 55* 273
promoter R AACCCTTAAAAACTAAAAAACC   
  1. F, forward primer; R, reverse primer
  2. *Dimethyl sulfoxide (5%) was added to the PCR mixture.