Skip to main content

Table 1 Mouse primer sequences

From: Aberrant methylation of Polo-like kinase CpG islands in Plk4 heterozygous mice

Target Gene Sense Primer Antisense Primer
Plk1 U 5'aca aac acc tct ttt ata tct aca tc 3' 5'tgg ttt gag tat tag ttg att ttg g 3'
Plk1 M 5'acg aac acc tct ttt ata tct acg tc 3' 5'gtt ggt tcg agt att agt cga ttt c 3'
Plk2 U 5' caa act tta ccc aaa acc tac tcac 3' 5'ata ggg tta gtt tgg atg ttt gtt t 3'
Plk2 M 5' aaa ctt tac cca aaa cct act cg 3' 5'ggt tag ttc gga cgt ttg ttc 3'
Plk4 U 5'cac act ctc cac ttc tta aaa aca a 3' 5' att tta tta tta gtg ttt gtg tta tgg 3'
Plk4 M 5'aca ctc tcc act tct taa aaa cga a 3' 5' aat tta tta tta gcg ttc gcg tta c 3'
B1 Element U 5'-taa cct caa act caa aaa tcc acc-3' 5'gtt ggg tgt agt ggt ata tat ttt taa ttt ta 3'
B1 Element M 5'ctcgaactcaaaaatccgcc 3' 5' gtc ggg cgt agt ggt ata tat ttt t 3'