Skip to main content

Table 1 Information about the primers and probes used in qRT-PCR

From: Squamocin modulates histone H3 phosphorylation levels and induces G1 phase arrest and apoptosis in cancer cells

Gene Forward primer Reverse primer Probe
aurora B attgctgacttcggctggt gtccagggtgccacacat 69
GAPDH agccacatcgctcagacac gcccaatacgaccaaatcc 60
MSK1 tggtgctgacagattttggt caaaaggaatatgctctttcagtttc 5