Skip to main content

Advertisement

Table 1 Primer sequences for real-time PCR

From: STAT3 activation in monocytes accelerates liver cancer progression

genes Forward primer (5'...3') Reverse primer (5'...3')
TNF-α AAGCCTGTAGCCCACGTCGTA AGGTACAACCCATCGGCTGG
IL-1β AAAAAAGCCTCGTGCTGTCG GTCGTTGCTTGGTTCTCCTTG
IL-6 TCCATCCAGTTGCCTTCTTG TTCCACGATTTCCCAGAGAAC
MCP-1 TCAGCCAGATGCAGTTAACGC TCTGGACCCATTCCTTCTTGG
IFN-γ GCCCTCTCTGGCTGTTACTG CTGATGGCCTGGTTGTCTTT
18 s GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG