Skip to main content

Table 2 Primers used sequencing

From: Hepatitis B virus core promoter mutations G1613A and C1653T are significantly associated with hepatocellular carcinoma in genotype C HBV-infected patients

Primer Nucleotide Sequence (5' 3') Position  
HB1F AAGCTCTGCTAGATCCCAGAGT 18-39 Sense
HB1R GAAACATAGAGGTGCCTTGAGCAG 557-534 Antisense
HB2F TGCTGCTATGCCTCATCTTC 414-433 Sense
HB2R CATACTTTCCAATCAATAGG 989-970 Antisense
HB3F GCCAAGTCTGTACAACATCTTGAG 760-783 Sense
HB3R AGTTGGCGAGAAAGTGAAAGCCTG 1107-1084 Antisense
HB4F CCTATTGATTGGAAAGTATGTCA 970-992 Sense
HB4R CGGGACGTAGACAAAGGACGT 1434-1414 Antisense
HB5F CTCTGCCGATCCATACTGCGGAA 1256-1278 Sense
HB5R TTAACCTAATCTCCTCCCCCA 1761-1741 Antisense
HB6F TTGTYTACGTCCCGTCGGCG 1421-1440 Sense
HB6R AACAGACCAATTTATGCCTA 1803-1784 Antisense
HB7F GAGACCACCGTGAACGCCCA 1611-1630 Sense
HB7R CCTGAGTGCTGTATGGTGAGG 2072-2048 Antisense
HB8F TTCACCTCTGCCTAATCATC 1824-1843 Sense
HB8R ATAGGGGCATTTGGTGGTCT 2314-2278 Antisense
HB9F TCAGGCAACTATTGTGGTTTCA 2190-2211 Sense
HB9R GGATAGAACCTAGCAGGCAT 2654-2635 Antisense
HB10F CGCAGAAGATCTCAATCTCGG 2417-2437 Sense
HB10R GGGTTGAAGTCCCAATCTGGATT 2987-2965 Antisense
HB11F GGGTCACCATATTCTTGGGAA 2814-2834 Sense
HB11R GAACTGGAGCCACCAGCAGG 75-56 Antisense
HB12F GTGGAGCCCTCAGGCTCAGG 3075-3094 Sense
HB12R CGAGTCTAGACTCTGTGGTA 256-237 Antisense