Skip to main content

Table 1 List of primer sequences used for mRNA expression of 14-3-3γ and GAPDH

From: P53 suppresses expression of the 14-3-3gamma oncogene

  Forward (5' > 3') Reverse (5' > 3')
14-3-3γ CTGAATGAGCCACTGTCGAA GCACGGACCATCTCAATCTT
GAPDH AGGGCCCTGACAACTCTTTT AGGGGTCTACATGGCAACTG