Fatty acid binding proteins (FABPs) in prostate, bladder and kidney cancer cell lines and the use of IL-FABP as survival predictor in patients with renal cell carcinoma

Table 4 Sequences of primer sets and UPL probes

Gene	Accession number	Primer	Sequences (5'...3')	Product size[bp]	UPL probe*
L-FABP1	NM_001443	Forward	ttctccggcaagtaccaact	93	72
		Reverse	cttccccttctggatgagc
I-FABP2	NM_000134	Forward	acaacctagcagacggaactg	78	1
		Reverse	tccgtttgaattttccaataagtt
H-FABP3	NM_004102	Forward	ctgggcacctggaagcta	77	56
		Reverse	ctggtagcaaaacccacacc
A-FABP4	NM_001442	Forward	cctttaaaaatactgagatttccttca	105	72
		Reverse	ggacacccccatctaaggtt
E-FABP5	NM_001444	Forward	gcagacccctctctgcac	138	56
		Reverse	tcgcaaagctattcccactc
IL-FABP6	NM_001445	Forward	ctcagagatcgtgggtgaca	68	22
		Reverse	tcacgcgctcataggtca
B-FABP7	NM_001446	Forward	ctcagcacattcaagaacacg	69	33
		Reverse	ccatccaggctaacaacagac
TBP	NM_003194	Forward	ttcggagagttctgggattgta	227
		Reverse	tggactgttcttcactcttggc
			Probe: F-ccgtggttcgtggctctcttatcctcaT-P
PPIA	NM_021130	Forward	Hs_PPIA_I_SG	121
		Reverse	QuantiTect Primer Assay
			Qiagen (Cat. No. QT00052311)

ISSN: 1471-2407