Figure 3From: Regulation of gene expression in ovarian cancer cells by luteinizing hormone receptor expression and activation qRT-PCR measures of gene TNFSF10 and ET-1. The left panel shows the normalized Ct of TNFSF10 (primer sequence (F) AAGACTGTCAGCTTCCAAACATTAA(R) GTGATACACTACT TGAGAGATGGAT) and the right panel shows the normalized Ct of ET-1 (primer sequence (F) AGGCCCTGAGTTGGCAGTGGCCCAT (R) ATGGGCCACTGCCAACTCAGGGCCT).Back to article page