Skip to main content

Table 2 Primers used for methylation analysis

From: COX-2 gene expression in colon cancer tissue related to regulating factors and promoter methylation status

  Tag Primer Sequence (5'-3') Bp
1 FP1692 CCACTCACTCACCCACCCGAAGAAGAAAAGATATTTGG 448
1 RP2104 GGGTGGGAGGTGGGAGGGATAAACTTTACTATCTAAAA  
2 B1(1595) CCACTCACTCACCCACCCTTGGAGAGGAAGTTAAGTGTTT 223
2 b1(1782) GGGTGGGAGGTGGGAGGGATCCCCACTCTCCTATCTAAT