Skip to main content

Table 2 Quantitative methylation-specific PCR primer and TaqMan probe sequences used in the present study

From: Highly frequent promoter methylation and PIK3CA amplification in non-small cell lung cancer (NSCLC)

Genes Forward primer sequence (5'→3') Probe sequence (5'→3') Reverse primer sequence (5'→3')
CALCA GTTTTGGAAGTATGAGGGTGACG 6FAM-ATTCCGCCAATACACAACAACCAATAAACG-TAMRA TTCCCGCCGCTATAAATCG
CDH1 AATTTTAGGTTAGAGGGTTATCGCGT 6FAM-CGCCCACCCGACCTCGCAT-TAMRA  TCCCCAAAACGAAACTAACGAC 
DAPK1 GGATAGTCGGATCGAGTTAACGTC  6FAM-TTCGGTAATTCGTAGCGGTAGGGTTTGG-TAMRA  CCCTCCCAAACGCCGA 
EVX2 TCGTTGGCGGGTGGGTATAG 6FAM-CTTCACTCCAAACCGCTCCTCATCTCCCG-TAMRA ACGCCGATAACAACCATTTTAACG
PAX6 ATATAGGACGGCGGTTTAGGTTG  6FAM-CCCAAAATCCGACCGACTCCAACCCCTA-TAMRA  TTCCGACCGAACGAAAACCTAC 
RASSF1A GCGTTGAAGTCGGGGTTC   6FAM-ACAAACGCGAACCGAACGAAACCA-TAMRA   CCCGTACTTCGCTAACTTTAAACG  
β-Actin TGGTGATGGAGGAGGTTTAGTAAGT  6FAM-ACCACCACCCAACACACAATAACAAACACA-TAMRA  AACCAATAAAACCTACTCCTCCCTTAA