Skip to main content

Table 1 Primers for RT-PCR analysis of differentially expressed genes induced by latexin expression in MGC803 cells.

From: Latexin expression is downregulated in human gastric carcinomas and exhibits tumor suppressor potential

Gene symbol Primers, 5'-3' Annealing (°C) Cycles (N) Product (bp)
S100P   59 24 161
F CGTGGATAAATTGCTCAAGGAC    
R TCTGCCAGGAATCTGTGACATC    
PDGFRB   57 30 605
F CTCAGGCCACGATGAAAGTG    
R GTCTCTGTGGACGCAGTTC    
SLPI   57 22 239
F AACCTGAGTGCCAGAGTGAC    
R AACGCAGGATTTCCCACACA    
Maspin   57 23 378
F AATGCCAAGGTCAAACTCTCC    
R GCATCCACAGAAAAGTCAGG    
WFDC1   59 26 314
F GCTATGAGTGCCACATCCTGAG    
R ATCTCTGGGGTCTTGCTCTGCT    
FBN2   59 25 561
F GAATGCTCCAATCCCAATGC    
R GCTGTCATCGTTCCCTTGAG    
A2M   57 22 408
F CATTGGCTATCTCAACACTGG    
R TGGTCCCCTTCTTGTGCTGTC    
BCHE   59 25 520
F CATTACACAGACTGGGTAGATG    
R CTTTCCACTCCCATTCTGCTTC    
NEP   57 26 404
F CTTCGATGACAATGGCAGAAAC    
R GCAAAGTCCCAATAATCCTGA    
β-actin   57 21 638
F GGAGAAAATCTGGCACCACAC    
R CGTACAGGTCTTTGCGGATGT