Skip to main content

Table 1 PCR primer sequences for human papillomavirus (HPV) and β-globin

From: Comparison of prevalence, viral load, physical status and expression of human papillomavirus-16, -18 and -58 in esophageal and cervical cancer: a case-control study

Gene Primer Primer Sequence (5'→3') Product AT(°C)
HPV-16 E6/7 F* GAATGTGTGTACTGCAAGCA 195 bp 56
  R GTTGTATTGCTGTTCTAAGTTGT   
HPV-16 E2 F ACTGTGGTAGAGGGTCA 177 bp 56
  R TTCGTTGCTGCTAAA   
HPV-18 E6/7 F GTATGGACCTAAGGCAACA 155 bp 52
  R GTCGGGCTGGCAAA   
HPV-18 E2 F ACGGTATCCGCTACTCAG 140 bp 52
  R GTCTCCGCAAGTCCA   
HPV-58 E6/7 F ATGTGACAGCTCAGACGAGG 166 bp 53
  R CAGCTGCTGTAGGGTTCGT   
HPV-58 E2 F GTGGGTAGTCGGGTAA 129 bp 53
  R TCGTCGTCGCTTTG   
β-globin F AACAGCATCAGGAGTGGAC 102 bp 52
  R CTGCCTATTGGTCTATTTTCC   
  1. *Forward.
  2. Reverse.
  3. Annealing Temperature.