Skip to main content

Table 2 Sequences of forward and reverse primers (5'-3') used for PCR and sequencing

From: Targeting EGFR/HER2 pathways enhances the antiproliferative effect of gemcitabine in biliary tract and gallbladder carcinomas

Gene Exon Forward primer Reverse primer
EGFR 18 TCAGAGCCTGTGTTTCTACCAA TGGTCTCACAGGACCACTGATT
EGFR 19 AAATAATCAGTGTGATTCGTGGAG GAGGCCAGTGCTGTCTCTAAGG
EGFR 20 ACTTCACAGCCCTGCCGTAAAC ATGGGACAGGCACTGATTTGT
EGFR 21 GCAGCGGGTTACATCTTCTTTC CAGCTCTGGCTCACACTACCAG
PIK3CA 9 GGGAAAAATATGACAAAGAAAGC CTGAGATCAGCCAAATTCAGTT
PIK3CA 20 CTCAATGATGCTTGGCTCTG TGGAATCCAGAGTGAGCTTTC
KRAS 1 GGTGGAGTATTTGATAGTGTATTAACC AGAATGGTCCTGCACCAGTAA
BRAF 15 TGCTTGCTCTGATAGGAAAATG AGCATCTCAGGGCCAAAAAT
PTEN 5 GCAACATTTCTAAAGTTACCTA CTGTTTTCCAATAAATTCTCA
PTEN 6 CATAGCAATTTAGTGAAATAACT GATATGGTTAAGAAAACTGTTC
PTEN 7 CAGTTAAAGGCATTTCCTGTG GGATATTTCTCCCAATGAAAG
PTEN 8 CTCAGATTGCCTTATAATAGTC AACTTGTCAAGCAAGTTCTTC
PTEN 9 GTTCATCTGCAAAATGGA GGTAATCTGACACAATGTCCTA
HER2 18 GTGAAGTCCTCCCAGCCCGC CTCCCATCAGAACTGCCGACC
HER2 19 TGGAGGACAAGTAATGATCTCCTGG AGACCAGAGCCCAGACCTG
HER2 20 GCCATGGCTGTGGTTTGTGATGG ATCCTAGCCCCTTGTGGACATAGG
HER2 21 GGACTCTTGCTGGGCATGTGG CCACTCAGAGTTCTCCCATGG
HER2 22 CCATGGGAGAACTCTGAGTGG TCCCTTCACATGCTGAGGTGG
HER2 23 AGACTCCTGAGCAGAACCTCTG AGCCAGCACAGCTCAGCCAC