Skip to main content

Table 2 Oligonucleotide specifications.

From: SHOX2 DNA Methylation is a Biomarker for the diagnosis of lung cancer based on bronchial aspirates

Concentration [μM]  
Total Quantification Assay Methylation Quantification Assay Sequence (5' → 3')
0.3 0.5 GTTTTTTGGATAGTTAGGTAAT
0.15 0.15 CCTCCTACCTTCTAACCC
0.15 NA 6-FAM-CCGGGGTTGTATGAGTATAGGCCCCGG-BHQ1-C18-CCTCCTACCTTCTAACCC
NA 0.15 6-FAM-CCGGGGTTGTATGAGTATAGGCCCCGG-BHQ1-C18-CCTCCTACCTTCTAACCC
NA 1 TAATTTTTGTTTTGTTTGTTTGATTGGGGTTGTATGA-SpacerC3
NA 1 ACCCAACTTAAACAACAAACCCTTTA-SpacerC3
  1. All oligonucleotides were supplied from biomers.net GmbH, Ulm, Germany.