Skip to main content

Table 1 Primer sequences of 38 DEGs and β-actin used for the quantitative real-time PCR.

From: Identification of differentially expressed genes using an annealing control primer system in stage III serous ovarian carcinoma

DEG Forward Reverse Amplicon size
NM_003143.1 AAAGATCCCTGAATCGTGTGC TCGCCACATCTCATTAGTTGC 119
AY871274 GTCCACTGCACAGTTCGAGG GGCCTCCTCTTTGCTGATTC 279
NM_022873.2 CAGAAGGCGGTATCGCTTTTC CCTGCATCCTTACCCGCATT 89
NM_001355.3 AGCGCCCACTTCTTTGAGTTT TCCCTATCTTGCCAATCTGCC 106
BC000523 GTGCCTAAGACAGAAATTCGGG TGCAAGTCTATGTTTGGGTTCAT 174
NM_005532 GCAGCCTTGTGGCTACTCTG TAGAACCTCGCAATGACAGCC 112
NM_207429.2 GGAGCTCCTTGGAAGTCAGG GCCAGCAACAGCACTGAGAT 129
BC012823 CGCTCTCTTTTCTCCCGTTT TCGCAGCATGCTCAACATTA 236
NM_020529 CTCCGAGACTTTCGAGGAAATAC GCCATTGTAGTTGGTAGCCTTCA 135
NM_001101654 GTGCAATCGCCATTACTGCT GAATGCAGGGTGTAAGGGGT 248
NM_001867 AAAGGTCTTGGTGAGGTGCC ACGGACCACAGAGGTTGTGA 119
BC013003 TCAGCACCTTGGAACCTTTGA AAGACACTCTCTCGGTAGTCATT 100
NM_000978 TCCTCTGGTGCGAAATTCCG CGTCCCTTGATCCCCTTCAC 119
NM_032470 TTGTCCAGATAGCGGCAAAC AGCGAGCTCTGGAAGAGGAG 149
NM_013974.1 GGTCGATGGAGTCCGCAAAG GGTGAAGAGAACGTCAGTGC 100
XM_002345433 CGAGTTCGTGGACCTGTACG GCCATTAAACCTGCCTGTGA 127
NM_001034996 CATGCCGGAAAATTGGTCGC CACTGTGCGGAAACTTGAGGA 145
NM_001037637 CATCTCTGGCAGCGAACACTT AGTCAGACTATCCGCACCAAG 107
BC107854 AGGGGTAAGCTCATCGCAGT CCGGAAAGTGTCTTCGATCTCA 150
NM_001020 TCGGACGCAAGAAGACAGC AGCAGCTTGTACTGTAGCGTG 118
NR_003225 GAAACCCAAACCCTCAAGGA GCACTTGGCTGTCCAGAAGA 247
NM_001004333.3 ATTCCTTGCGCTTATTGAGCC GCCCCCAGAACATATACAACCT 123
NM_080390 TGCAGGGAGGATCAAAGACA GGCTCTCCCTCACTCTCTGG 103
NM_013318 AAGCCCTCTGGATCAGCAGT TCAGTAGGGAGAGGCGAGGT 227
EF177379 GTTTCCAGGCCTTGCTCA ATTCATGGGCTCTGGAACAA 158
AK026649 GGTTCTCGCTCTTGTCGTGTC ATATCCTTCGCGTACTGACGG 101
AK302766 TGGCTTTGTAACAAGTGCTGC CGGAGCTATGTTCCGAAGAATG 168
NM_032682 TCCCGTGTCAGTGGCTATGAT CTCTTTAGGCTGTTTTCCAGCAT 226
NG_001229 TCATGAGGCCCAGATCAAGA ACCACGTCCTTCCCTTTCAG 219
AK025219 AGGACCAGAACTGCAAGCTG GCGCTCTTCCAAGTCAGTGA 155
BC001120 GCAGACAATTTTTCGCTCCA GCACTTGGCTGTCCAGAAGA 287
NM_032508.1 ATGAACCTGAGGGGCCTCTT TGATGCCATCCAAACGAAGGG 106
NM_002292.3 ATGCTGGTGGAACGCTCAG CTCGCCTTCAGTGGATGGC 171
AK293439 GGTCCAGAAGGCTCTCAAGC GGGCCTCAGGTAATGGTGTT 265
NM_001131005 AGACATCGTGGAGGCATTGA GTGGCAATAGGTTGGGGTTT 263
NM_201442 CAAGTCCCATACAACAAACTCCA CAGGAGCAGAAGTAACCACCA 176
BC023599 TCCCTTGTCCGGAGGATATT TAATGGATTCAATCATCTTTATTAACC 164
NM_001100167 TCTGAAGAGTCCCCCAAATG AATCCAGCACTTCCTCTCCA 209
β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT 154
\