Skip to main content

Table 2 PCR Primers used for FLT3 ITD Backtracking on Guthrie card DNA: Northern California Childhood Leukemia Study

From: FLT3mutation incidence and timing of origin in a population case series of pediatric leukemia

Primer Name Primer Sequences (5'(3')
ITD-R2 AGACAAATGGTGAGTACGTGCA
ITD-4-F ATATGATCTCtccgagggcc
ITD-87-F TATGAATATGAgTTCAGAGAATATG
ITD-104-F GAGTTTCCcctcgggaag
ITD-261-F AGAGAATATGAGACCGGCTC
ITD-1073-F* GAGTACTTCccCAGAGAATATG
ITD-1148-F AGAGAATATGAgTACGTTGATTTC
  1. bold, WT sequence; underlined, ITD; lower case, N nucleotides
  2. *1073 had an 11 bp deletion with a 2 bp insertion, giving an overall deletion of 9 bp.
  3. ITD-R2 was used as the reverse primer for all the backtracking reactions.