Skip to main content

Table 1 Primers used for RT-PCR in the present study

From: Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

Primer Forward reverse
β-Actin AAGCCACCCCACTTCTCTCTAA AATGCTATCACCTCCCCTGTGT
Bcl-2 ATGTGTGTGGAGAGCGTCAA ACAGTTCCACAAAGGCATCC
Survivin GTTGCGCTTTCCTTTCTGTC TCTCCGCAGTTTCCTCAAAT
XIAP CACTTGAGGTTCTGGTTGCAG TGCAAAGCTTCTCCTCTTGC
STAT1 AATGCTGGCACCAGAACGAA ATCACCACAACGGGCAGAGA
IFNB GCAATTGAATGGGAGGCTTG GGCGTCCTCCTTCTGGAACT