Skip to main content

Table 1 Primers and probes used for bisulfite sequencing and MSP analysis

From: hTERT promoter activity and CpG methylation in HPV-induced carcinogenesis

Sequence primers/
Location
Sequences
hTERT S1/-442 to -219 F 5' GGGTTATTTTATAGTTTAGGT 3'
  R 5' AATCCCCAATCCCTC 3'
hTERT S2/-208 to +104 F 5' GTTTTGTTTTTTTATTTTTTAGTTT 3'
  R 5' CCAACCCTAAAACCCCAAA 3'
hTERT S3/+88 to +348 F 5' TTTGGGGTTTTAGGGTTGG-3'
  R 5' AACCACCAACTCCTTCAAA-3'
hTERT S4/+319 to +566 F 5' GTAGGTGTTTTGTTTGAAGGA-3'
  R 5' TACCAACAAATAAACCAAC-3'
MSP primers/
Location
Sequences*
hTERT M1/-317 to -262 F 5' TAGATTTTCGGGTTCGTTCG 3'
  R 5' TCTATACCCGCGAATCCACT 3'
  P 5' CGACCTAACCCCGACAACGCAACTA 3'
hTERT M2/+288 to +419 F 5' GAGTAGCGTAGGCGATTTAGGGCGT 3'
  R 5' GTCCAACAACGCGAAACCGAA 3'
  P 5' CGCACAACCTCTACAACACTCGAACCACCAACTC 3'
β actin F 5' TGGTGATGGAGGAGGTTTAGTAAGT 3'
  R 5' AACCAATAAAACCTACTCCTCCCTTAA 3'
  P 5' ACCACCACCCAACACACAATAACAAACACA 3'
  1. *Methylation specific CpGs are printed in bold